View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9351_low_30 (Length: 230)

Name: NF9351_low_30
Description: NF9351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9351_low_30
NF9351_low_30
[»] chr1 (2 HSPs)
chr1 (23-199)||(8812660-8812835)
chr1 (70-160)||(4773844-4773934)


Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 23 - 199
Target Start/End: Complemental strand, 8812835 - 8812660
Alignment:
23 tgggtctattcatgattatcccggggatgatcaagctacatcacactagatgatttagttacagtaggttttagttttagatgcaataatgcaaaggtct 122  Q
    ||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8812835 tgggtctat-catgattatcccggggttgatcaagctacatcacactagatgatttagttacagtaggttttagttttagatgcaataatgcaaaggtct 8812737  T
123 tttggtacagcgattcattaagtttgttcaggcccgtgcttcagttttgctgtgtctgattaagcatattgtagggg 199  Q
    ||||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||||||||||| ||||||    
8812736 tttgggacagcgattcattaagtttgttcaggcctgtgcttcagttttgttgtgtttgattaagcatattttagggg 8812660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 70 - 160
Target Start/End: Original strand, 4773844 - 4773934
Alignment:
70 agatgatttagttacagtaggttttagttttagatgcaataatgcaaaggtcttttggtacagcgattcattaagtttgttcaggcccgtg 160  Q
    ||||||||||| |  ||||||||||||||||| ||||||||||||||||||||||||||| || ||| |||||||| |||| |||||||||    
4773844 agatgatttagatgaagtaggttttagttttatatgcaataatgcaaaggtcttttggtatagtgatccattaagtctgtttaggcccgtg 4773934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University