View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9351_low_5 (Length: 435)
Name: NF9351_low_5
Description: NF9351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9351_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 17 - 215
Target Start/End: Original strand, 39801129 - 39801327
Alignment:
| Q |
17 |
aaacatctctatgatgaggcccatatacttaaccctttcacctctatggatggggtcctcctagggccatcctagtgatgcgccccttgcctgaaaccta |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39801129 |
aaacatctctatgatgaggcccatatacttaaccctttcacctctatggatggggtcctcctagggccatcctagggatgcgccccttgcctgaaaccta |
39801228 |
T |
|
| Q |
117 |
aaaagaaatggagatttaagctcattaaaaaacttgttatggggttccattcctgattatttgtctaggtctaagcttgctttgtttccatgtatctgc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39801229 |
aaaagaaatggagatttaagctcattaaaaaacttgttatggggttccattcctgattatttgtctaggtctaagcttgctttgtttccatgtatctgc |
39801327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 166; E-Value: 1e-88
Query Start/End: Original strand, 216 - 414
Target Start/End: Original strand, 39801385 - 39801583
Alignment:
| Q |
216 |
aatcagtagacatgcaatctgatttgttctagaaccttcactttagtatctacatttaactttattttcttacatggagtcccatacagagtcagttcgc |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39801385 |
aatcagtagacatgcaatctgatttgttctagaaccttcactttagtatctacatttaactttattttcttacatggagtcccatacagaatcagttcgc |
39801484 |
T |
|
| Q |
316 |
ttgtggttttgttctcnnnnnnngggctattaggttagcaggtggttggaatataatagaagtagaattatatctcaaattctcaatggttaggtcata |
414 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39801485 |
ttgtggttttgttctctttttttgggctattaggttagcaagtggttggaatataatagaagtagaattatatctcaaattctcaatggttagggcata |
39801583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University