View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9352_low_10 (Length: 254)
Name: NF9352_low_10
Description: NF9352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9352_low_10 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 3 - 254
Target Start/End: Complemental strand, 44991087 - 44990836
Alignment:
| Q |
3 |
aggagcagcacagaagcagacatgttcactgtgacatacacaggagatcataaccatgcaagacctacccatcggaactcactagccggaagtacacgaa |
102 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
44991087 |
aggagcaacactgaagcagacatgttcactgtgacatacacaggagatcataaccatgcaagacctacccatcggaactcactagccggtagtacacgaa |
44990988 |
T |
|
| Q |
103 |
ccaagtctccggtgacacatccaaccacttcaatttctggtcaacccaacagttcaatttcttcttgctcttctttagcaccaaactcttttgctgaaga |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44990987 |
ccaagtctccggtgacacatccaaccacttcaatttctggtcaacccaacagctcaatttcttcttgctcttctttagcaccaaactcttttgctgaaga |
44990888 |
T |
|
| Q |
203 |
agaagaagacatcgacatggaaattgaaactgatgatgatggtgaagatagt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44990887 |
agaagaagacatcgacatggaaattgaaactgatgatgatggtgaagatagt |
44990836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University