View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9352_low_12 (Length: 253)
Name: NF9352_low_12
Description: NF9352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9352_low_12 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 108 - 253
Target Start/End: Original strand, 35631500 - 35631645
Alignment:
| Q |
108 |
ttatatagaccaacatgtatggtattgggttaatagatgtgttattagacttgacccaacccaaagtccaatccataacactatgcgacgaatttggtac |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35631500 |
ttatatagaccaacatgtatggtattgggttaatagatgtgttattagacttgacccaacccaaagtccaatccataacactatgcgacgaatttggtac |
35631599 |
T |
|
| Q |
208 |
aattattgtttgaaaaaatgagtgagggaaaaaatgatcactaatt |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35631600 |
cattattgtttgaaaaaatgagtgagggaaaaaatgatcactaatt |
35631645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 3 - 106
Target Start/End: Original strand, 35629688 - 35629798
Alignment:
| Q |
3 |
ggtgggtagataatactggagagggtgtacatgcaaagacc-------tcgctcaaggtggatgttatgattagaatgagcataccttgttaggttgtga |
95 |
Q |
| |
|
||||||| ||||| | ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35629688 |
ggtgggttgataacaatggagagggtgtacatgcaaagaccctgacgctcgctcaaggtggatgttatgattagaatgagcataccttgttaggttgtga |
35629787 |
T |
|
| Q |
96 |
ggcgagactta |
106 |
Q |
| |
|
||||||||||| |
|
|
| T |
35629788 |
ggcgagactta |
35629798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University