View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9352_low_13 (Length: 245)
Name: NF9352_low_13
Description: NF9352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9352_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 6 - 229
Target Start/End: Original strand, 32472417 - 32472640
Alignment:
| Q |
6 |
ttggtgttgggaatttcttgaacagttttttggtaacaatgactgataagataacaggaagaggggatagaaagagttggattgctgataacttgaatga |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32472417 |
ttggtgttgggaatttcttgaacagttttttggtaacaatgactgataagataacaggaagaggggatagaaagagttggattgctgataacttgaatga |
32472516 |
T |
|
| Q |
106 |
ttctcacttagattactattatgggtttcttttgatcttgtcaagtgttaatttgttggtgtttctttgggtttcaagtagatacatttacaaaaaggag |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32472517 |
ttctcacttagattactattatgggtttcttttgatcttgtcaagtgttaatttgttggtgtttctttgggtttcaagtagatacatttacaagaaggag |
32472616 |
T |
|
| Q |
206 |
tcatcaagaatcaaagaagcactt |
229 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
32472617 |
tcatcaagaatcaaagaagcactt |
32472640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University