View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9352_low_16 (Length: 237)

Name: NF9352_low_16
Description: NF9352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9352_low_16
NF9352_low_16
[»] chr3 (1 HSPs)
chr3 (1-157)||(25378559-25378715)


Alignment Details
Target: chr3 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 25378715 - 25378559
Alignment:
1 ctgaatggaattcagaatcagaacaacgttgagttgcatcttgggaatatgaatttttcagaggggaagagagagatggatttgttggagttggtttctt 100  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25378715 ctgaatggaattcagaatcagaacaacgtggagttgcatcttgggaatatgaatttttcagaggggaagagagagatggatttgttggagttggtttctt 25378616  T
101 ctgctcagttttattagtgctgctgctggtgattctaaaatgatgaatctatcattt 157  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25378615 ctgctcagttttattagtgctgctgctggtgattctaaaatgatgaatctatcattt 25378559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University