View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9352_low_17 (Length: 236)
Name: NF9352_low_17
Description: NF9352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9352_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 78 - 226
Target Start/End: Complemental strand, 3523129 - 3522981
Alignment:
| Q |
78 |
catcaaaaactagttcggttctcaaatcagaaggttcatgacttcatcttccatcgactataagacaagaggtcttcatgtatttttctaaacctttctc |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3523129 |
catcaaaaactagttcggttctcaaatcagaaggttcatgacttcatctttcatcgactataagacaagaggtcttcatgtatttttctaaacctttctc |
3523030 |
T |
 |
| Q |
178 |
ttatgtcaactgagaaatacctacttttgacatagtaatctctgcttct |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
3523029 |
ttatgtcaactgagaaatacctacttttgacatagtagtctttgcttct |
3522981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 64
Target Start/End: Complemental strand, 3524402 - 3524357
Alignment:
| Q |
19 |
gttcaacgagggtgactctaacttgactttctttcatgcttgcatc |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3524402 |
gttcaacgagggtgactctaacttgactttctttcatgcttgcatc |
3524357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University