View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9354_low_11 (Length: 265)
Name: NF9354_low_11
Description: NF9354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9354_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 48490544 - 48490798
Alignment:
| Q |
1 |
ttgcatccagaattgattataactcgaagttagaatttgaaacttttgccttccaaattgattcttttattgaatattggaaacctttcagattatagga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48490544 |
ttgcatccagaattgattataactcgaagttagaatttgaaacttttgccttccaaattgattcttttattgaatattggaaacctttcagattatagga |
48490643 |
T |
|
| Q |
101 |
aaagaaagcataatatattggaacacaattagttgctctccaatatttgttttttcagaag--nnnnnnnngttatttcatattattaaaatatagtatc |
198 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
48490644 |
aaagaaagcataatatattggaaaacaattagttgctctccaatatttgttttttcagaagaagaaaaaaagttatttcatattattaaaatatagtatc |
48490743 |
T |
|
| Q |
199 |
aaacatagataaacataaccttgaatatgacaacttgttatagatatgaccacca |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48490744 |
aaacatagataaacataaccttgaatatgacaacttgttatagatatgaccacca |
48490798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 9 - 51
Target Start/End: Complemental strand, 7328729 - 7328687
Alignment:
| Q |
9 |
agaattgattataactcgaagttagaatttgaaacttttgcct |
51 |
Q |
| |
|
|||||||||| ||||| |||| ||||||||||||||||||||| |
|
|
| T |
7328729 |
agaattgattctaacttgaagctagaatttgaaacttttgcct |
7328687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University