View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9355_high_2 (Length: 254)
Name: NF9355_high_2
Description: NF9355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9355_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 31 - 139
Target Start/End: Complemental strand, 49244423 - 49244315
Alignment:
| Q |
31 |
tgaaaaccaattttgtgtaacnnnnnnnctagttatttccatcattgtttaatttgttttcaattaatgttgatttcagatgttgggatatatttaaggg |
130 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49244423 |
tgaaaaccaattttgtgtaactttttttctagttatttccatcattgtttaatttgttttcaattaatgttgatttcagatgttgggatatatttaaggg |
49244324 |
T |
 |
| Q |
131 |
gttgaatgg |
139 |
Q |
| |
|
||||||||| |
|
|
| T |
49244323 |
gttgaatgg |
49244315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 169 - 254
Target Start/End: Complemental strand, 49244285 - 49244200
Alignment:
| Q |
169 |
tggtactagcttatttgtgttgaaatggtttgtagtgggtagttgaatagattctaacaatgcccatgtgattgtgacgctttctt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
49244285 |
tggtactagcttatttgtgttgaaatggtttgtagtgggtggttgaatagattctaacaatggccatgtgattgtcacgctttctt |
49244200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University