View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9355_low_1 (Length: 409)
Name: NF9355_low_1
Description: NF9355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9355_low_1 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 2e-87; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 2e-87
Query Start/End: Original strand, 109 - 300
Target Start/End: Complemental strand, 28251410 - 28251219
Alignment:
| Q |
109 |
atcccccttcctgaaccctctagtagcattgaaataaccatgagatttcccattaatggaaactgagagaaaagataatcttaaaataactagaatccat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||||||||||| |
|
|
| T |
28251410 |
atcccccttcctgaaccctctagtagcattgaaataaccatgagatttcccattaatggaaactgagagaaaagatgattttaaagtaactagaatccat |
28251311 |
T |
|
| Q |
209 |
ttgcaaaaagcttcattgaaaccaaagcttctaagaacttttagcataaaataccattcaagagtatcaaaagcttttctaatgtcaatctt |
300 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28251310 |
tttcaaaaagcttcattgaaaccaaagcttctaaaaacttttagcaggaaataccattcaagagtatcaaaagcttttctaatgtcaatctt |
28251219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 6 - 114
Target Start/End: Complemental strand, 28252234 - 28252127
Alignment:
| Q |
6 |
ccttgtccctttgattctctatactttgcctgctttcacaagctttgttatgcttctacttaaaacatcttcaaactaagcaaaatagaagtaggtaaag |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
28252234 |
ccttgtccctttgattctctatactttgcctactttcacaagctttgttatgcttctacttaaaacatcttc-aactaagcaaaatagaagtagggaaag |
28252136 |
T |
|
| Q |
106 |
agaatcccc |
114 |
Q |
| |
|
||||||||| |
|
|
| T |
28252135 |
agaatcccc |
28252127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 368 - 398
Target Start/End: Complemental strand, 28251225 - 28251195
Alignment:
| Q |
368 |
caatcttttatgtttctatcatgaatgaaca |
398 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
28251225 |
caatcttttatgtttctatcatgaatgaaca |
28251195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 46 - 78
Target Start/End: Original strand, 32249099 - 32249131
Alignment:
| Q |
46 |
agctttgttatgcttctacttaaaacatcttca |
78 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
32249099 |
agctttgtaatgcttctacttaaaacatcttca |
32249131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University