View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9355_low_7 (Length: 240)
Name: NF9355_low_7
Description: NF9355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9355_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 14 - 225
Target Start/End: Original strand, 25813996 - 25814207
Alignment:
| Q |
14 |
taattctgatggatactgggtactaagaagatcgtggccaaataatttggtatactcaaaggtatgtgttgatcaatttgaagcatgcaaagaaccacaa |
113 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25813996 |
taattctgatggatactgagtactaagaagatcgtggccaaataatttggtatactcaaaggtatgtgttgatcaatttgaagcatgcaaagaacaacaa |
25814095 |
T |
 |
| Q |
114 |
ctaaagaaaggtctttggtgggcgaattcagatgaggactacgaattcgacacttgcattaattgtcgtcttgacttggaagtggattggttcctgaaag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25814096 |
ctaaagaaaggtctttggtgggcgaattcagatgaggactacgaattcgacacttgcattaattgtcgtcttgacttggaagtggattggttcctgaaag |
25814195 |
T |
 |
| Q |
214 |
aagtgaagtacg |
225 |
Q |
| |
|
|||||||||||| |
|
|
| T |
25814196 |
aagtgaagtacg |
25814207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University