View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9355_low_9 (Length: 238)
Name: NF9355_low_9
Description: NF9355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9355_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 6739011 - 6738793
Alignment:
| Q |
1 |
ctttgttcggaagttaccaatatttatacccaaaaattaggttaaagtaggaggaagaggccaaaagatgcttggctggagatggtgcaaagttggtggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6739011 |
ctttgttcggaagttaccaatatttatacccaaaaattaggttaaagtaggaggaagaggccaaaagatgcttggctggagatggtgcaaagttggtggt |
6738912 |
T |
 |
| Q |
101 |
ttgcgcagtgtcacagaaatgcataatgtgtgataataagagctcaaaatgggagagggaaataacaaattataaagatagctttgaagtcacctaaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6738911 |
ttgcgcagtgtcacagaaatgcataatgtgtg---ataagagctcaaaatgggagagggaaataacaaattat--agatagctttgaagtcacctaaatt |
6738817 |
T |
 |
| Q |
201 |
gaaatgagcagttgaaatagtttt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
6738816 |
gaaatgagcagttgaaatagtttt |
6738793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 20 - 71
Target Start/End: Complemental strand, 38512906 - 38512855
Alignment:
| Q |
20 |
atatttatacccaaaaattaggttaaagtaggaggaagaggccaaaagatgc |
71 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38512906 |
atatttatactaaaaaaataggttaaagtaggaggaagaggccaaaagatgc |
38512855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University