View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9356_low_18 (Length: 318)
Name: NF9356_low_18
Description: NF9356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9356_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 24 - 299
Target Start/End: Original strand, 49919037 - 49919312
Alignment:
| Q |
24 |
acggtgatgttgatggttacatctccatatgcggctacggttctctcctctccggnnnnnnnnnnnnnnnnnnnnnnnnnttcctataaagaattattca |
123 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
49919037 |
acggtgacgttgatggttacatctccatatgcggctacggttctctcctctccggtaactaactaactaattaactaactttcctataaagaattattca |
49919136 |
T |
 |
| Q |
124 |
atcatcactctcttaaactaactctaaccctttgacagagaaaagtgctagaagcacgtttcctcacctaattaacttccgaaccgccaggttaactggt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49919137 |
atcatcactctcttaaactaactctaaccctttgacagagaaaagtgctagaagcacgtttcctcacctaattaacttccgaaccgccaggttaactggt |
49919236 |
T |
 |
| Q |
224 |
tttcgccgtctcttctcggttgtaggagccttcttttttaatcatggcatagccaacctcaaaactcaggtgatgt |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49919237 |
tttcgccgtctcttctcggttgtaggagccttcttttttaatcatggcatagccaacctcaaaactcaggtgatgt |
49919312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University