View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9356_low_35 (Length: 226)

Name: NF9356_low_35
Description: NF9356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9356_low_35
NF9356_low_35
[»] chr2 (1 HSPs)
chr2 (132-210)||(40023994-40024072)


Alignment Details
Target: chr2 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 132 - 210
Target Start/End: Original strand, 40023994 - 40024072
Alignment:
132 tgatagttttataggaaccacaaacaaatttattttttgttattaaccctccgatttacagagaaaaagggtctatagt 210  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||    
40023994 tgatagttttataggaaccacaaacaaatttattttttgttattaaccctccgatttacaaagaaaaagggcctatagt 40024072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University