View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9356_low_39 (Length: 217)
Name: NF9356_low_39
Description: NF9356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9356_low_39 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 5e-95; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 50392201 - 50392405
Alignment:
| Q |
1 |
atgaatgttttctctaatatgaaaatatcatcaggatcatggatattgctctctcacatcaagaaactccacaataaataatattatgggtgttcaacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50392201 |
atgaatgttttctctaatatgaaaatatcatcaggatcatggatattgctctctcacatcaagaaactccacaataaataatattatgggtgttcaacaa |
50392300 |
T |
 |
| Q |
101 |
taagcctttctagtgaaaggtttgttatgagtgatattgctatgtgctttgctatttctttgtttcacaggtttcttgccaaaagttcatgtttttattc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50392301 |
taagcctttctagtgaaaggtttgttatgagtgata------------ttgctatttctttgtttcacaggtttcttgccaaaagttcatgtttttattc |
50392388 |
T |
 |
| Q |
201 |
tcttgttgaaatttttc |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
50392389 |
tcttgttgaaatttttc |
50392405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 147 - 183
Target Start/End: Complemental strand, 33735314 - 33735278
Alignment:
| Q |
147 |
ctttgctatttctttgtttcacaggtttcttgccaaa |
183 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
33735314 |
ctttgctatttctttgttacacaagtttcttgccaaa |
33735278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University