View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9356_low_4 (Length: 398)
Name: NF9356_low_4
Description: NF9356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9356_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 6 - 384
Target Start/End: Original strand, 607642 - 608026
Alignment:
| Q |
6 |
gtttggtgttgtcttcctcagtatgcgaggttcatgtgctctgtgttttatgtgacgtatcttgtgtacacgttgtgtcttgtgcatcattgcactatcc |
105 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
607642 |
gtttgttgttgtgttcctcagtatgcgaggttcatgtgctctgtgtcttatgtgacgtatcttgtgtacacgttgtgtcttgtgcatcattgcactatcc |
607741 |
T |
|
| Q |
106 |
tctgtaacgcctctttttacgatgtcc-----atgtgacgcgcaacctatcgcgatatgtatatacaagattgcttgttttatcttttgtgacattggct |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| ||||||||| |||||||||||||||||||||||||| ||||||||||||||||| || |
|
|
| T |
607742 |
tctgtaacgcctctttttacgatgtccatattatgtgacgcgaaacctatcgagatatgtatatacaagattgcttgttctatcttttgtgacattgtct |
607841 |
T |
|
| Q |
201 |
cgtgtgtgttgttgctcgttgcgtcgtcgcttttaaggcttgtaacttgttttggagnnnnnnng-ttggcatcatcatcgtctcctcatattcaacata |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||||||||||||||||| |
|
|
| T |
607842 |
cgtgtgtgttgttgctcgttgcgtcgtcgcttttaaggcttgtaacttgttttggagtttttttgtttggcttcatcatcgtctcctcatattcaacata |
607941 |
T |
|
| Q |
300 |
tttgacaacgtgaaattagcgacgatctttcaccaaccaagcaatgtcattccttcacacaaaccttaaatgatgtgattgatgt |
384 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
607942 |
tttgacaacgtgaaattagcgacgattcttcaccaaccaagcaatgtcattccttcacacaagccttaaatgatgtgattgatgt |
608026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University