View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9356_low_40 (Length: 209)
Name: NF9356_low_40
Description: NF9356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9356_low_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 12 - 193
Target Start/End: Original strand, 3274213 - 3274400
Alignment:
| Q |
12 |
cagaatcatagaggggcatcctcaaatttatgtcg------tcgtcgtcgccactgtcgtcgttgacgttgtaattattatgggttattgggtgtatttc |
105 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3274213 |
cagaatcatggaggggcatcctcaaatttatgtcgtcgtcgtcgtcgtcgccactgtcgtcgttgacgttgtaattattatgggttattgggtgtatttc |
3274312 |
T |
 |
| Q |
106 |
tcttatgtgaccgtggtcgttgacattgttatcttcctccacagacgtcataaaaagtctccaaaaagattgaatggtatggtacatt |
193 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3274313 |
tcttatgtgaccgtggtcgatgacattgttatcttcctccacagacgtcataaaaagtctccaaaaagattgcatggtatggtacatt |
3274400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University