View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9357_high_15 (Length: 316)
Name: NF9357_high_15
Description: NF9357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9357_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 138; Significance: 4e-72; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 172 - 313
Target Start/End: Original strand, 12616110 - 12616251
Alignment:
| Q |
172 |
atactaatggaaaagtgaccaattcagatggagactgaaccaaaaattgaagagcttactaccttgaagtatttgacttcgtatgccacgttggttcaca |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12616110 |
atactaatggaaaagtgaccaattcagatggagactgaaccaaaaattgaagagcttactaccttgaagtatttgacttcatatgccacgttggttcaca |
12616209 |
T |
 |
| Q |
272 |
aagttgcgatgtagatgaagctttataagatgtatattatga |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12616210 |
aagttgcgatgtagatgaagctttataagatgtatattatga |
12616251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University