View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9357_high_20 (Length: 249)
Name: NF9357_high_20
Description: NF9357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9357_high_20 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 34012221 - 34011965
Alignment:
| Q |
1 |
tgacgatatcgtcgatgtcatcatcagtggtgttgtagtaatagtgttgcatgtttgaattaaaacttgagtgatgttgatcgggggccatggatggagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34012221 |
tgacgatatcgtcgatgtcatcatcagtggtgttgtagtaatagtgttgcatgtttgaattaaaacttgagtgatgttgatcgggggccatggatggagg |
34012122 |
T |
 |
| Q |
101 |
atatatgatcaannnnnnnnnnnnn--------atgaagaaaaaatgaagtggttagttagttatattaagggaaatgagatgcatgcaaagggtaagag |
192 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34012121 |
atatatgatcagagagagagagagagagagagaatgaagaaaaaattgagtggttagttagttatattaagggaaatgagatgcatgcaaagggtaagag |
34012022 |
T |
 |
| Q |
193 |
tgaggtgggaagagagaacatgaaaggaaactgatggatggtagctagcttttggag |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34012021 |
tgaggtgggaagagagaacatgaaaggaaactgatggatggtagctagcttttggag |
34011965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University