View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9357_high_7 (Length: 382)
Name: NF9357_high_7
Description: NF9357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9357_high_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-115; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 9 - 277
Target Start/End: Complemental strand, 18715859 - 18715596
Alignment:
| Q |
9 |
gatggatgagaggaaagagacgtgtaggtcatcatcaatggagttgtcaagttctccatacacaaaggaccaaatgttttcaactgggattatggcactt |
108 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18715859 |
gatggatgagaggaaagagaagtgtagatcatcatcaatggagttgtcaagttctccatacacaaaggaccaaatgttttcaactgggattatggcactt |
18715760 |
T |
|
| Q |
109 |
tagagataaacattttatcatatgatatgatttatatcatatgataatttaaggctatatttacataattaagataagataagatactttggttgaaacc |
208 |
Q |
| |
|
||||||| || | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18715759 |
tagagattaatactttatcatatgatatgatttatatcatatgataatttaaggctatatttacataattaagataagataagatactttggttgaaacc |
18715660 |
T |
|
| Q |
209 |
aaaaccaaaaggaatttttgatcgg-aaaaatacaaagattttgaatttatgaaacatagtaataaattg |
277 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
18715659 |
------aaaaggaatttttgatcggaaaaaatacagagattttgaatttgtgaaacatagtaataaattg |
18715596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 325 - 361
Target Start/End: Complemental strand, 18715548 - 18715512
Alignment:
| Q |
325 |
gcagagaactatgaagttgggatctcaattttgcaca |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18715548 |
gcagagaactatgaagttgggatctcaattttgcaca |
18715512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University