View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9357_low_100 (Length: 212)
Name: NF9357_low_100
Description: NF9357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9357_low_100 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 20 - 196
Target Start/End: Original strand, 7685400 - 7685576
Alignment:
| Q |
20 |
ttgttgggaagcaacatgataatctaagacaaacaaattttggcggtcaacaaggagttagttagggtgagcagtagacgacaaattcatttggaagtga |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7685400 |
ttgttgggaagcaacatgataatctaagacaaacaaattttggcggtcaacaaggagttagttagggtgagcagtagacgagaaattcatttggaagtga |
7685499 |
T |
 |
| Q |
120 |
ttatgaatcctagacatactctaaacaataccatacgaaagacctttctaggagtgtcaaatctctttcaaagtctc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
7685500 |
ttatgaatcctagacatactctaaacaataccataccaaagacctttctaggagtgtcaaatatctttcacagtctc |
7685576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 63; Significance: 1e-27; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 20 - 114
Target Start/End: Original strand, 38979387 - 38979479
Alignment:
| Q |
20 |
ttgttgggaagcaacatgataatctaagacaaacaaattttggcggtcaacaaggagttagttagggtgagcagtagacgacaaattcatttgga |
114 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| | | ||||||||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38979387 |
ttgttgggaagcaacatgataatcta-gacaaacaaatctggacggtcaacaaggagt-agttagggtgagcagtagacgacaaattcatctgga |
38979479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University