View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9357_low_14 (Length: 422)
Name: NF9357_low_14
Description: NF9357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9357_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 6 - 412
Target Start/End: Original strand, 25577157 - 25577587
Alignment:
| Q |
6 |
agaaattttacaaccataactgatacaatgcaactagttgaatgatatgcctcttctgagggaagagctaggtaattggaggaaatgtggttgggga--- |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25577157 |
agaaattttacaaccataactgatacaatgcaactagttgaatgatatgcctcttctgagggaagagctaggtaattggagggaatgtggttggggaact |
25577256 |
T |
|
| Q |
103 |
-----------------ttattattgttgtt---ttatggggcacgattcacctcaatcaaataaactggatttatctatttacacatctgagtacttgg |
182 |
Q |
| |
|
| |||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
25577257 |
tacggtggccgacatggtgattattattgttgttttatggggcacgattcacctcaatcaaataaactggatttatctatttacacatctgagtacatgg |
25577356 |
T |
|
| Q |
183 |
ttctgattgtcgtgtgcaattgatgtggtatatggggtgcctaagtctcaaatcgagtagtatgtgatgcttggtggagtgtggaatggttcctctccct |
282 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25577357 |
ttctgattgtcatgtgcaattgatgtggtatatggggtgcctaagtctcaaatcgagtagtatgtgatgctcagtggagtgtggaatggttcctctccct |
25577456 |
T |
|
| Q |
283 |
tgacagctactcctgctgtttctttttagatgtcgttttagaactttttaaacatttcaagacacttttgagaaaattattaatc-tatagttttactat |
381 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
25577457 |
tgacagctactcctgctgtttctttttagatgtcgttttagaactttttaaacatttcaagacacttttgataaaattattaatcttatagttttactat |
25577556 |
T |
|
| Q |
382 |
ttttgataaaattatttatcttttctctatg |
412 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |
|
|
| T |
25577557 |
ttttgataaaattattaatcttttctctatg |
25577587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University