View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9357_low_17 (Length: 413)
Name: NF9357_low_17
Description: NF9357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9357_low_17 |
 | |
|
| [»] scaffold0002 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0002 (Bit Score: 341; Significance: 0; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 21 - 406
Target Start/End: Complemental strand, 373332 - 372945
Alignment:
| Q |
21 |
tttagagcgctaagtcgagactttctatggtacattgttgatcccctaccgtgtgcagcaaaaagccggtttatgtagaggttgtcccaaattggtcatg |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
373332 |
tttagagcgctaagtcgagactttctatggtacattgttgatcccctaccgtgcgcatcaaaaagccggtttatgtagaggttgtcccaaattggtcatg |
373233 |
T |
|
| Q |
121 |
catccatattgtggcgttggctacctttatgcttcaacaaatttggcctaacctggaagagatcaaactgattctggcaaaagggatgaaacatggttcc |
220 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
373232 |
catccatactgtggcgttggctacatttatgcttcaacaaattcggcctaacctggaagagatcaaactgattctggaaaaagggatgaaacatggttcc |
373133 |
T |
|
| Q |
221 |
aatagggccaaataaattaatcacattctggaagtatacgctagcgaagggttttctgagaacgaggttatttccgcctttcgggacctctttgaatgac |
320 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
373132 |
aatagggccaaatacattaatctcattctggaagtatacgctagcgaagggttttctgagaacgaggttatttccgcctttcgggacctctttgaacgac |
373033 |
T |
|
| Q |
321 |
gtcaactcgccaactgcagggatactatcttgaatacggtgggtccacatttttc--attgaatgttctcttctttaggcctatgctt |
406 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
373032 |
gtcaactcgccaactgcagggatactatcttgaatacggtgggtccacatttttcatattgaatgttctcttctttaggcctatgctt |
372945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 57; Significance: 1e-23; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 44 - 171
Target Start/End: Complemental strand, 19919297 - 19919169
Alignment:
| Q |
44 |
tctatggtacattgttgatcccctaccgtgtgcagcaaaaagccggtttatgtagaggttgtcccaaattggtcatgcatc-catattgtggcgttggct |
142 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||| ||| ||||||||||| ||||||| || ||| |||||||||||| ||| | |||| |||||| |
|
|
| T |
19919297 |
tctatggtacatcgttgatcccttaccgtgtgcagcgaaacgccggtttatgcagaggttatctaaaagtggtcatgcatcatatagtctggctttggct |
19919198 |
T |
|
| Q |
143 |
acctttatgcttcaacaaatttggcctaa |
171 |
Q |
| |
|
||||||||||| || |||||| ||||||| |
|
|
| T |
19919197 |
acctttatgctccagcaaattcggcctaa |
19919169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 260 - 353
Target Start/End: Complemental strand, 19919099 - 19919006
Alignment:
| Q |
260 |
gctagcgaagggttttctgagaacgaggttatttccgcctttcgggacctctttgaatgacgtcaactcgccaactgcagggatactatcttga |
353 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||| ||||||| |||||||| | |||||||||||||||||||||||||| |||| |||| |
|
|
| T |
19919099 |
gctagcgaagggttttctgagaacggggttctttcttcctttcgaaacctctttaaccgacgtcaactcgccaactgcagggatgctattttga |
19919006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University