View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9357_low_50 (Length: 316)
Name: NF9357_low_50
Description: NF9357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9357_low_50 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 114 - 304
Target Start/End: Complemental strand, 2046799 - 2046609
Alignment:
| Q |
114 |
taacacaaaatcaataaaattcaaccccatgttctcattaatgactctgatacaatattaagatcactaaacacaaattgaatcgaatttctagcgagaa |
213 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2046799 |
taacacaaaatcaataaaattcaatcccatgttctcattaatgactctgatacaatattaagatcactaaacacaaattgaatcgaatttcttgcgagaa |
2046700 |
T |
 |
| Q |
214 |
actcacgtaggcagtagcacggaagtaatagtttattcatctcttaactaaataagcaagaatcatgcgagagaaaaaggaagaagaataa |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2046699 |
actcacgtaggcagtagcacggaagtaatagtttattcatctcttaactaaataagcaagaatcatgcgagagaaaaaggaagaagaataa |
2046609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 159 - 207
Target Start/End: Complemental strand, 38695607 - 38695559
Alignment:
| Q |
159 |
tctgatacaatattaagatcactaaacacaaattgaatcgaatttctag |
207 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
38695607 |
tctgatacaatattaagatcactaaacagaaattgaaatgaatttctag |
38695559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 220
Target Start/End: Complemental strand, 23241129 - 23241076
Alignment:
| Q |
167 |
aatattaagatcactaaacacaaattgaatcgaatttctagcgagaaactcacg |
220 |
Q |
| |
|
||||||||||||||||||||||||||| | || ||||||| |||| ||||||| |
|
|
| T |
23241129 |
aatattaagatcactaaacacaaattgcaacggatttctaaggagatactcacg |
23241076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University