View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9357_low_68 (Length: 262)
Name: NF9357_low_68
Description: NF9357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9357_low_68 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 18 - 255
Target Start/End: Complemental strand, 46752254 - 46752014
Alignment:
| Q |
18 |
ttagcaaggctctccaccactgactttggattttagatgtctttttctaaagaaatcttatttcatgagattagtctccatagttaaatgtgcagattaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46752254 |
ttagcaaggctctccaccactgactttggattttagatgtcttgttataaagaaatcttgtttcatgagattagtctccatagttaaatgtgcagattaa |
46752155 |
T |
|
| Q |
118 |
ttaagttataataatgatttcggttaaaaattgaagtcgtgactagatgctgcttaacacat-cccatcccacatctaataatctgtcaatactacgttg |
216 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
46752154 |
ttaagttataataatcatttcggttaaaaattgaagtcgtgactagatgctgcttaacacatacacatcccacatctaataatctgtcaatactacgttg |
46752055 |
T |
|
| Q |
217 |
gt----gaaacataagtgatatgaatatgttttgcctttgctt |
255 |
Q |
| |
|
|| |||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
46752054 |
gtgaaagaaacataagtgatatga--atgttttgcttttgctt |
46752014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University