View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9357_low_70 (Length: 257)
Name: NF9357_low_70
Description: NF9357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9357_low_70 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 45128286 - 45128519
Alignment:
| Q |
1 |
atcattggcccaataaaattacaagttaatttagcttagtgagaagcaccaaggttttaaaaacagatccagggacaactatttgggctgtgacatcaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |||||| |
|
|
| T |
45128286 |
atcattggcccaataaaattacaagttattttagcttagtgagaagcaccaaggttttaaaaacagatccacggacaactattcgggctgtgaaatcaag |
45128385 |
T |
|
| Q |
101 |
gttttgatgtcttggcgacctcaaatgaggccacataaaccacatttaactttgattctaagaaattagagaatgcgaccgcaagcagtttaaaaccttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45128386 |
gttttgatgtcttggcgacctcaaatgagg---------ccacatttaactttgattctaagaaattagagaatgcgaccgcaagcagtttaaaaccttg |
45128476 |
T |
|
| Q |
201 |
agaatgacttacttgctgcagacatcccacttgcgaactccaa |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45128477 |
agaatgacttacttgctgcagacatcccacttgcgaactccaa |
45128519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University