View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9357_low_71 (Length: 257)
Name: NF9357_low_71
Description: NF9357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9357_low_71 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 37554358 - 37554600
Alignment:
| Q |
1 |
gaagatgaaactacccacggggttatttgagtggtccacgcaattcaggaaatatgaga--gagaggtgtatcaccagtaataaaaaagagtacatgtga |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37554358 |
gaagatgaaactacccacggggttatttgagtggtccacgcaattcaggaaatatgagagagagaggtgtatcaccagtaataaaaaagagtacatgtga |
37554457 |
T |
 |
| Q |
99 |
gttgtgactagctagtataagagattattttttcttcttcttttattgtgcaaaataatgaaaccatattccttatgggaggtgtatatgnnnnnnnnnn |
198 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37554458 |
gttgtgactggctagtataagagattatttttt-ttcttattttattgtgcaaaataatgaaaccatattccttatgggaggagtatatgaaaaaacaaa |
37554556 |
T |
 |
| Q |
199 |
nntaatacgagcattatcttttttacaataataatagtaataag |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37554557 |
aataatacgagcattatcttttttacaataataatagtaataag |
37554600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University