View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9357_low_73 (Length: 254)
Name: NF9357_low_73
Description: NF9357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9357_low_73 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 132 - 254
Target Start/End: Complemental strand, 20753046 - 20752924
Alignment:
| Q |
132 |
tatgttggggcatgcatattgattattggtaatagtaatataaaatttttgttttgctaatatttgcataaaatcaacaaattttgtttgactcgccatg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
20753046 |
tatgttggggcatgcatattgattattggtaatagtaatataaaaattttgttttgctaatatttgcataaaatcaacaaattttgtttgacttgccatg |
20752947 |
T |
|
| Q |
232 |
gtatatttggttgcagctgaaaa |
254 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
20752946 |
gtatatttggttgcagctgaaaa |
20752924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University