View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9357_low_75 (Length: 253)
Name: NF9357_low_75
Description: NF9357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9357_low_75 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 23 - 236
Target Start/End: Original strand, 3566913 - 3567127
Alignment:
| Q |
23 |
cactaatcaatcatggttagattcttgtcattcccttacattatcaaccctcacaaaacatcattct-gacaactaatctcttttgctagatgttcaagt |
121 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3566913 |
cactaatcagtcatggttagattcttgtcattcccttacattatcaaccctcacaaaacatcattctagacaactaatctcttttgctagatgttcaagt |
3567012 |
T |
|
| Q |
122 |
taataacatactttttgcttctcagttcaaattcatgagaatgtgggtttctcatcctgattgttccacaattgttagagatagctggagttttaatgtg |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3567013 |
taataacatactttttgcttctcagttcaaattcatgagaatgtgggtttctcatcctgattgttccacaattgttagagatagctggatttttaatgtg |
3567112 |
T |
|
| Q |
222 |
attggttgccctatg |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
3567113 |
attggttgccctatg |
3567127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University