View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9357_low_88 (Length: 240)
Name: NF9357_low_88
Description: NF9357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9357_low_88 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 47105807 - 47105587
Alignment:
| Q |
18 |
aaacttctggtaatgacgtgataggatacgattaaatgacaaaattatcactgtaaccccaattatatattttcttttcaaattaacttgtcttattttc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47105807 |
aaacttctggtaatgacgtgataggatatgattaaattacaaaattatcattgtaaccccaattatatattttcttttcaaattaacttgtcttattttc |
47105708 |
T |
|
| Q |
118 |
aaagacaattatttagtaaattttcaaaaagacatagaagaacgtcaacacaaccgctgcattataaaaagaacacgtgtctgattgccattttctcctt |
217 |
Q |
| |
|
||||| | ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47105707 |
aaagatatttatttagtaaattttcaaaaagacat--aagaacgtcaacacaaccgctgcattataaaaagaacacgtgtctgattgccattttctcctt |
47105610 |
T |
|
| Q |
218 |
aaatggataggatctgcactcat |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
47105609 |
aaatggataggatctgcactcat |
47105587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University