View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9357_low_92 (Length: 238)
Name: NF9357_low_92
Description: NF9357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9357_low_92 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 34012206 - 34012429
Alignment:
| Q |
1 |
atcgacgatatcgtcaacaacgaggttgttaacgatagcgacgagtacgaggaggacgagtatcagtatcactacgaagaagattatgaaaaagaagaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34012206 |
atcgacgatatcgtcaacaacgaggttgttaacgatagcgacgagtacgaggaggacgagtatcagtatcactacgaagaagatgatgaaaaagaagaaa |
34012305 |
T |
|
| Q |
101 |
ccaaacagccacaaaaacgttgttcatcttctttttcattgagtaaggtattacttgatccaagaggaaaatgggctgaagaatggaatagagtatttct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34012306 |
ccaaacagccacaaaaacgttgttcatcttctttttcattgagtaaggtattacttgatccaagaggaaaatgggctgaagaatggaatagagtatttct |
34012405 |
T |
|
| Q |
201 |
tttggtgtgtgcaatggggttatt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
34012406 |
tttggtgtgtgcaatggggttatt |
34012429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University