View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9357_low_94 (Length: 237)
Name: NF9357_low_94
Description: NF9357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9357_low_94 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 14 - 220
Target Start/End: Complemental strand, 15430317 - 15430110
Alignment:
| Q |
14 |
aatcaaagatgaccctcataaactccgacttaaattctccctaaaaatctttgatgaagacaaaattgattccatcaaacccaagacttttaaaattttc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | | ||||||||||||||||||| |
|
|
| T |
15430317 |
aatcaaagatgaccctcataaactccgacttaaattctccctaaaaatctttgacgaagacaaaattgattccataaggctcaagacttttaaaattttc |
15430218 |
T |
 |
| Q |
114 |
acaatcccacattgcgtgtttaacctcctcttcactaaccattctaaagagacctccactatcagtcatgttgagacacttt-aaatcaaatcatccaac |
212 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
15430217 |
acaatcccacattgtgtgtttaacctcctcttcactaaccattctaaagagacctccactatcagtcatgttgagacactttaaaatcaaatcatccaaa |
15430118 |
T |
 |
| Q |
213 |
caaggtct |
220 |
Q |
| |
|
|||||||| |
|
|
| T |
15430117 |
caaggtct |
15430110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University