View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9357_low_98 (Length: 225)
Name: NF9357_low_98
Description: NF9357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9357_low_98 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 18 - 209
Target Start/End: Complemental strand, 41170934 - 41170742
Alignment:
| Q |
18 |
aatatacctaataaagcaaccaggaagggtaaaaaa-gcttagtttgtcccttatatggcatgtaattctattggtagcggatgtggtagagaacattaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41170934 |
aatatacctaataaagcaaccaggaagggtaaaaaaagcttagtttgtcccttatatggcatgtaattctattggtagcggatgtggtagagaacattaa |
41170835 |
T |
 |
| Q |
117 |
ggtgttgtcgtggcattgagcccttgtaattgtatggtgaggtagttgggtttaatcggtctcgttgtcttgtaattgtttgagctttagaat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
41170834 |
ggtgttgtcgtggcattgagcccttgtaattgtatggtgaggtagttgggtttaatcggtctagttgttttgtaattgtttgagctttagaat |
41170742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University