View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9358_high_6 (Length: 285)

Name: NF9358_high_6
Description: NF9358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9358_high_6
NF9358_high_6
[»] chr3 (2 HSPs)
chr3 (21-86)||(21787608-21787673)
chr3 (62-141)||(21794332-21794412)


Alignment Details
Target: chr3 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 21 - 86
Target Start/End: Complemental strand, 21787673 - 21787608
Alignment:
21 gatgatgattaattttgctcttttaattcatttatatgcacagcaactttgtttccactcctcatg 86  Q
    |||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||    
21787673 gatgatgattaattttgcacttttaattcattgatatgcacagcaactttgtttccactcctcatg 21787608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 62 - 141
Target Start/End: Complemental strand, 21794412 - 21794332
Alignment:
62 agcaactttgtttccactcctcatgtcaatta-ggtttttcaaatagtcaacagaattctctggattggaatgcttgtttc 141  Q
    |||||| ||||||| ||||||||||||||||| |||||  |||  ||| ||||||||||| ||||| |||||  |||||||    
21794412 agcaacgttgtttcaactcctcatgtcaattagggtttcgcaagaagttaacagaattctttggataggaattattgtttc 21794332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University