View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9358_high_6 (Length: 285)
Name: NF9358_high_6
Description: NF9358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9358_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 21 - 86
Target Start/End: Complemental strand, 21787673 - 21787608
Alignment:
| Q |
21 |
gatgatgattaattttgctcttttaattcatttatatgcacagcaactttgtttccactcctcatg |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21787673 |
gatgatgattaattttgcacttttaattcattgatatgcacagcaactttgtttccactcctcatg |
21787608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 62 - 141
Target Start/End: Complemental strand, 21794412 - 21794332
Alignment:
| Q |
62 |
agcaactttgtttccactcctcatgtcaatta-ggtttttcaaatagtcaacagaattctctggattggaatgcttgtttc |
141 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||| ||||| ||| ||| ||||||||||| ||||| ||||| ||||||| |
|
|
| T |
21794412 |
agcaacgttgtttcaactcctcatgtcaattagggtttcgcaagaagttaacagaattctttggataggaattattgtttc |
21794332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University