View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9358_high_9 (Length: 234)
Name: NF9358_high_9
Description: NF9358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9358_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 171
Target Start/End: Original strand, 18485166 - 18485336
Alignment:
| Q |
1 |
ccaaaatttctgctgttacggccattgctacttctgagcagcttgcagttcagtttgctattctggaagatccggtggttcagcaggttaatggtaacgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
18485166 |
ccaaaatttctgctgttacggccattgctacttctgagcagctcgcagttcagtctgctattctagaagatccggtggctcagcaggttaatggtaacgc |
18485265 |
T |
|
| Q |
101 |
aagttccgtcatgtctgaaggcagtagcatgctcgcggttcagtttaattttttggcagatgcggtagttc |
171 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18485266 |
aagttctgtcatgtctgaaggcagtagcatgctcgcggttcagtttaattttttggcagatgcggtagttc |
18485336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 175
Target Start/End: Original strand, 11212760 - 11212934
Alignment:
| Q |
1 |
ccaaaatttctgctgttacggccattgctacttctgagcagcttgcagttcagtttgctattctggaagatccggtggttcagcaggttaatggtaacgc |
100 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||| || |||||| || ||||||| || || ||| |||||||||| |||||||||||| |
|
|
| T |
11212760 |
ccaaagtttctgctgtttcggccattgctacttctgagtagctcgcgattcagtctgaaattctggcagctctggtagttcagcaggctaatggtaacgc |
11212859 |
T |
|
| Q |
101 |
aagttccgtcatgtctgaaggcagtagcatgctcgcggttcagtttaattttttggcagatgcggtagttcataa |
175 |
Q |
| |
|
| |||| |||||||| |||||||||||||||||||||||||||| | |||||||||||| ||||||||| ||||| |
|
|
| T |
11212860 |
aggttctgtcatgtccgaaggcagtagcatgctcgcggttcagtctgattttttggcagctgcggtagtccataa |
11212934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 225
Target Start/End: Original strand, 18485313 - 18485357
Alignment:
| Q |
181 |
attttttggcagatgcggtagttaaaaatggtaacacaggttctg |
225 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
18485313 |
attttttggcagatgcggtagttcttaatggtaacataggttctg |
18485357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 175
Target Start/End: Complemental strand, 34215981 - 34215807
Alignment:
| Q |
1 |
ccaaaatttctgctgttacggccattgctacttctgagcagcttgcagttcagtttgctattctggaagatccggtggttcagcaggttaatggtaacgc |
100 |
Q |
| |
|
|||||||||||| |||| ||||||||||| ||||| | ||||| || ||| |||||| ||||||| |||||||| |||||| |||||||||||||| | |
|
|
| T |
34215981 |
ccaaaatttctgttgtttcggccattgcttcttctaaacagctcgcggtttagtttgaaattctggcggatccggtagttcagtaggttaatggtaacac |
34215882 |
T |
|
| Q |
101 |
aagttccgtcatgtctgaaggcagtagcatgctcgcggttcagtttaattttttggcagatgcggtagttcataa |
175 |
Q |
| |
|
| |||| |||||||| |||| ||||||||||||| | |||||| ||||||||||| | | ||||||||||| |
|
|
| T |
34215881 |
aggttctgtcatgtccaaaggtagtagcatgctcgtgattcagtcagattttttggcaactactgtagttcataa |
34215807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 89 - 161
Target Start/End: Complemental strand, 34215809 - 34215737
Alignment:
| Q |
89 |
taatggtaacgcaagttccgtcatgtctgaaggcagtagcatgctcgcggttcagtttaattttttggcagat |
161 |
Q |
| |
|
||||||||| ||| ||| ||||||| ||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34215809 |
taatggtaaggcaggttatgtcatgttcgaaggcagtagcatgctcgcggttcagcctaattttttggcagat |
34215737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University