View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9358_low_24 (Length: 224)

Name: NF9358_low_24
Description: NF9358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9358_low_24
NF9358_low_24
[»] chr1 (1 HSPs)
chr1 (68-209)||(23878052-23878193)


Alignment Details
Target: chr1 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 68 - 209
Target Start/End: Complemental strand, 23878193 - 23878052
Alignment:
68 ttcaccagtctttttgtaaatgcatttcaaggcacaaattacgagtatttcaatcattcaaatctttattgatctagcagtggcctttacctgtaaccat 167  Q
    |||||||||||||||||| ||||||||||||||||||||||| ||| |||||||||||||||||||| ||||||||| |||| |||||||||||||||||    
23878193 ttcaccagtctttttgtacatgcatttcaaggcacaaattacaagtgtttcaatcattcaaatctttcttgatctagtagtgtcctttacctgtaaccat 23878094  T
168 ttcaggtctgactgaaaactcccaccatgatccatctctgct 209  Q
    ||||||||||||||||| |||||||| |||||||| ||||||    
23878093 ttcaggtctgactgaaagctcccaccgtgatccatttctgct 23878052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University