View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9358_low_24 (Length: 224)
Name: NF9358_low_24
Description: NF9358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9358_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 68 - 209
Target Start/End: Complemental strand, 23878193 - 23878052
Alignment:
| Q |
68 |
ttcaccagtctttttgtaaatgcatttcaaggcacaaattacgagtatttcaatcattcaaatctttattgatctagcagtggcctttacctgtaaccat |
167 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| ||| |||||||||||||||||||| ||||||||| |||| ||||||||||||||||| |
|
|
| T |
23878193 |
ttcaccagtctttttgtacatgcatttcaaggcacaaattacaagtgtttcaatcattcaaatctttcttgatctagtagtgtcctttacctgtaaccat |
23878094 |
T |
 |
| Q |
168 |
ttcaggtctgactgaaaactcccaccatgatccatctctgct |
209 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||| |||||| |
|
|
| T |
23878093 |
ttcaggtctgactgaaagctcccaccgtgatccatttctgct |
23878052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University