View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9359_low_21 (Length: 412)
Name: NF9359_low_21
Description: NF9359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9359_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 71 - 405
Target Start/End: Complemental strand, 27889594 - 27889282
Alignment:
| Q |
71 |
cgtgaggctataagacaattatgtttctcacttgagcattatagaaatgggtataatgttcttaggaaggctttcatagatcacaagaggtttccacttt |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
27889594 |
cgtgaggctataagacaattatgtttctcacttgagcattatagaaatggatataatgttcttagaaaggctttcatagatcacaagaggtttccacttt |
27889495 |
T |
|
| Q |
171 |
tggcatcataaggtatctatatggttgcattttgcatgtgatcttgtacaaaatgttttgaaatcccaactagacatcgaactggtgaaatctccgagtc |
270 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27889494 |
tggcatcataaggtatctgcatggttgcattgtgcatgtgatcttgtacaaaatgttttgaaatcctaactagacatcgaactggtgaaatctccgagtc |
27889395 |
T |
|
| Q |
271 |
atggttgttatgctttaaaccgctcggaccaagatgaaacaacggtcgaatcgctcagatgattgaagtagacagtgttggtttatggttcgaccggctg |
370 |
Q |
| |
|
|||||| | |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27889394 |
atggttctaatgctttaaaccgctc----------------------gaatcgctcagatgattgaagtagacagtgttggtttatggttcaaccggctg |
27889317 |
T |
|
| Q |
371 |
aatcggccggttcagttaggatactagtataatct |
405 |
Q |
| |
|
||| |||||||||||||||| |||| ||||||||| |
|
|
| T |
27889316 |
aattggccggttcagttagggtactggtataatct |
27889282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University