View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9359_low_31 (Length: 361)
Name: NF9359_low_31
Description: NF9359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9359_low_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 1e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 30 - 218
Target Start/End: Complemental strand, 5771149 - 5770961
Alignment:
| Q |
30 |
gtgcatcaatataattgacaaaacctactgctataattgttagtgaataataatatatgtacactccaatttatgaagagcttttctctctataattaag |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5771149 |
gtgcatcaatataattgacaaaacctactgctataattgttagggaataataatatatgtacactccaatttatgaagagcttttctctctataattaag |
5771050 |
T |
 |
| Q |
130 |
ccacgtatagacacgtaaggtgcaatggtgacatatggttttagacattgagtgcatgtaaatgtaaatgtggttaatggtatatattg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5771049 |
ccacgtatagacacgtaaggtgcaatggtgacatatggttgtagacattgagtgcatgtaaatgtaaatgtggttaatggtatatattg |
5770961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University