View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9359_low_55 (Length: 265)
Name: NF9359_low_55
Description: NF9359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9359_low_55 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 18 - 265
Target Start/End: Original strand, 41028999 - 41029246
Alignment:
| Q |
18 |
atcataattatgtagtcgttgtgcatgtaaaccaaccgaaaaacccgagtgtcaatgatttcgttttttctggcattcagtctaagaaagcaaccatcga |
117 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41028999 |
atcataattatgtagtcgttatgcatgtaaaccaaccgaaaaacccgagtgtcaatgatttcgttttttctggcgttcagtctaagaaagcaaccatcga |
41029098 |
T |
|
| Q |
118 |
accattcaacaatgtcaatcttaccctgtcagtgatgagtaactttccagctctcgacgggattggtatctctatggttagagcagaagtgggagtgaaa |
217 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41029099 |
actattcaacaatgtcaatcttaccctgtcagtgatgagtaactttccagctctcgacggcattggtatctctatggttagagcagaagtgggagtgaaa |
41029198 |
T |
|
| Q |
218 |
ggaagctaccctatgcacacacattatgttgccacagattttttgatc |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41029199 |
ggaagctaccctatgcacacacattatgttgccgcagattttttgatc |
41029246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University