View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9359_low_59 (Length: 252)
Name: NF9359_low_59
Description: NF9359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9359_low_59 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 13 - 228
Target Start/End: Original strand, 34825237 - 34825452
Alignment:
| Q |
13 |
ggtaggaaacacatgtcctagtatatactttgaaataataagagctttggatccatccaggaccaagctgggaaaatcttcacacttggttcttgatttt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34825237 |
ggtaggaaacacatgtcctagtatatactttgaaataataagagctttggatccatccaggaccaagctgggaaaatcttcacacttggttcttgatttt |
34825336 |
T |
|
| Q |
113 |
aaaatccacacccaccaatcaaacattaactgtgctgcttcatttggttccactcattgccaaaaatacacgtcagtggaggtggagtcagcgacataaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34825337 |
aaaatccacacccaccaatcaaacattaactgtgctgcttcatttggttccactcattgccaaaaatacacgtcagtgaaggtggagtcagcgacataaa |
34825436 |
T |
|
| Q |
213 |
caccatgccatgctgt |
228 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
34825437 |
caccatgccatgctgt |
34825452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University