View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9359_low_69 (Length: 224)
Name: NF9359_low_69
Description: NF9359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9359_low_69 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
| [»] scaffold0578 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 3096142 - 3096365
Alignment:
| Q |
1 |
tgggacaatttcttctgtggaccgttacttgaaaattgttcnnnnnnnccgatgacgacagaggtgccaccttccagaagtagaattttactgtcctctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3096142 |
tgggacaatttcttctgtggaccgttgcttgaaaattgttcaaaaacactgatgacgacagaggtgccaccttccagaagtagcattttactgtcctctt |
3096241 |
T |
 |
| Q |
101 |
cgtcctcgtgactaagaaggtgacttgatcattgccagtttgacaaaaacaaacgaaaacaaatatgagctgagttttgaggcacgcaaatttattttct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3096242 |
cgtcctcgtgactaagaaggtgacttgatcattgccggtttgacaaaaacaaacgaaaacaaatatgagctgagttttgaggcacgcaaatttattttct |
3096341 |
T |
 |
| Q |
201 |
attgttgtttccaaattgacatca |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
3096342 |
attgttgtttccaaattgacatca |
3096365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0578 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0578
Description:
Target: scaffold0578; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 145 - 200
Target Start/End: Complemental strand, 1077 - 1022
Alignment:
| Q |
145 |
aaaaacaaacgaaaacaaatatgagctgagttttgaggcacgcaaatttattttct |
200 |
Q |
| |
|
||||||||| | ||||||||||||||||| ||||||||||| || || |||||||| |
|
|
| T |
1077 |
aaaaacaaagggaaacaaatatgagctgaattttgaggcacacatatatattttct |
1022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 145 - 200
Target Start/End: Complemental strand, 4955089 - 4955034
Alignment:
| Q |
145 |
aaaaacaaacgaaaacaaatatgagctgagttttgaggcacgcaaatttattttct |
200 |
Q |
| |
|
||||||||| | ||||||||||||||||| ||||||||||| || || |||||||| |
|
|
| T |
4955089 |
aaaaacaaagggaaacaaatatgagctgaattttgaggcacacatatatattttct |
4955034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University