View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9360_low_1 (Length: 634)
Name: NF9360_low_1
Description: NF9360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9360_low_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-103; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 426 - 616
Target Start/End: Original strand, 38866177 - 38866367
Alignment:
| Q |
426 |
taacaataaccttaactccactctccccactaccatctccacttgcaccactctccgccatcttgatctctccctcaacctcttcgccggcaatatccct |
525 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38866177 |
taacaataaccttaactccactctccccactaccatctccacttgcaccactctccgccatcttgatctctccctcaacctcttcgccggcaatatccct |
38866276 |
T |
 |
| Q |
526 |
cacactctctccgacctccctctccaagaactcaacctctccttcaacaacttctccggcaacatcccacaaaccttcagcaacttccaac |
616 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38866277 |
cacactctctccgacctccctctccaagaactcaacctctccttcaacaacttctccggcaacatcccacaaaccttcagcaacttccaac |
38866367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 136; E-Value: 1e-70
Query Start/End: Original strand, 1 - 153
Target Start/End: Original strand, 38865756 - 38865904
Alignment:
| Q |
1 |
gaaaaacatttcccaagttagttaaattatgcacctagctactatgcccagtacaattaaattcaaaatgaggtgctccaaattctgatggcaacacaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38865756 |
gaaaaacatttcccaagttagttaaattatgcaccta----ctatgcccagtacaattaaattcaaaatgaggtgctccaaattctgatggcaacacaag |
38865851 |
T |
 |
| Q |
101 |
aatagaactaacattagaaacatagcaaaatggttgaactattattcatcatg |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38865852 |
aatagaactaacattagaaacatagcaaaatggttgaactattattcatcatg |
38865904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 96; E-Value: 9e-47
Query Start/End: Original strand, 267 - 362
Target Start/End: Original strand, 38866018 - 38866113
Alignment:
| Q |
267 |
ctggaaccctaacgactcatctccgtgcaactggaccggcatcctttgcaacaatctcaccaactccgtcacctccatcaacctccctaactccga |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38866018 |
ctggaaccctaacgactcatctccgtgcaactggaccggcatcctttgcaacaatctcaccaactccgtcacctccatcaacctccctaactccga |
38866113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University