View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9360_low_12 (Length: 404)
Name: NF9360_low_12
Description: NF9360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9360_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 382; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 382; E-Value: 0
Query Start/End: Original strand, 7 - 396
Target Start/End: Original strand, 50505197 - 50505586
Alignment:
| Q |
7 |
ataacaagagtcaactcatcatccaccccgcgccgaggaaaagccgttcgagaagccgctgatagagctctggcggtgacggccagaggaagaactcgtt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50505197 |
ataacaagagtcaactcatcatccaccccgcgccgaggaaaagccgttcgagaagccgctgatagagctctggcggtgacggccagaggaagaactcgtt |
50505296 |
T |
|
| Q |
107 |
ggagccggaccattctaatgacccggctcaagatcaagtttaggaagaaaaaacctaacagggtaacggcgctgccgtcaactaggtcaaagaagtcaag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50505297 |
ggagccggaccattctaatgacccggctcaagatcaagtttaggaagaaaaaacctaacagggtaacggcgctgccgtcaactaggtcaaagaagtcaag |
50505396 |
T |
|
| Q |
207 |
ggtcaatgttttccggttgaagggaaaggtggtaccaagtatgcaaaggaaagtaaggtttcttggagggttggttcctggttgcaaaaaggaaccatta |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50505397 |
ggtcaatgttttccggttgaagggaaaggtagtaccaagtatgcaaaggaaagtaaggtttcttggagggttggttcctggttgcaaaaaggaaccatta |
50505496 |
T |
|
| Q |
307 |
ccggtgattcttgaagaagctattgattatatacctgcacttgagatgcaggttagagccatgagtgctctttttaaccttctctctgct |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
50505497 |
ccggtgattcttgaagaagctattgattatatacctgcacttgagatgcaggttagagccatgagtgctctttttaaccttctttctgct |
50505586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 275 - 369
Target Start/End: Complemental strand, 12913730 - 12913636
Alignment:
| Q |
275 |
ggttggttcctggttgcaaaaaggaaccattaccggtgattcttgaagaagctattgattatatacctgcacttgagatgcaggttagagccatg |
369 |
Q |
| |
|
|||| ||||||||||| | ||| ||||| |||||||| ||||||||||||| ||||||||||||||| || ||||||||||| ||| | |||||| |
|
|
| T |
12913730 |
ggttagttcctggttgtagaaaagaaccgttaccggttattcttgaagaagttattgattatataccagctcttgagatgcaagttcgtgccatg |
12913636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University