View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9360_low_15 (Length: 360)
Name: NF9360_low_15
Description: NF9360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9360_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 2e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 8 - 144
Target Start/End: Original strand, 35235450 - 35235586
Alignment:
| Q |
8 |
ttggtgttggtgttgggaaagctaaggaagttgtttctgctgttcagaaatctgctattaatgctaggaggaatcttattagagttcctatgactaagta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35235450 |
ttggtgttggtgttgggaaagctaaggaagttgtttctgctgttcagaaatctgctattaatgctaggaggaatcttattagagttcctatgactaagta |
35235549 |
T |
 |
| Q |
108 |
cttgacttttcctcataggtaactttctctaactttc |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35235550 |
cttgacttttcctcataggtaactttctctaactttc |
35235586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University