View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9360_low_23 (Length: 317)
Name: NF9360_low_23
Description: NF9360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9360_low_23 |
 |  |
|
| [»] scaffold0057 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 4 - 264
Target Start/End: Original strand, 23360804 - 23361066
Alignment:
| Q |
4 |
tcactttactctctgttcctc--acaattcaggttttttcaaagaagagaaatgtcggtgacttcaagctctagaggaagaccaggtaccagagaaacta |
101 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23360804 |
tcactttactctctgttcctctcacaattcaggttttttcaaagaagagaaatgtcggtgacttcaagctctagaggaagaccaggtaccagagaaacta |
23360903 |
T |
 |
| Q |
102 |
gcccagagagaaccaaagtttggactgaacccaaacccaaaacacccagaaaagtctctgtagtttactacctctcacgtaatggccaccttgagcaccc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23360904 |
gcccagagagaaccaaagtttggactgaacccaaacccaaaacacccagaaaagtctctgtagtttactacctctcacgtaatggccaccttgaacaccc |
23361003 |
T |
 |
| Q |
202 |
ccatttcatggaagtccctctctcttcaccccatggtctctacctcaaaggtatgtactctca |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
23361004 |
ccatttcatggaagtccctctctcttcaccccatggtctctacctcaaaggtacgtactctca |
23361066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 267 - 308
Target Start/End: Complemental strand, 30162 - 30121
Alignment:
| Q |
267 |
tgtagcaccgacacttctgatcaaatgtgtgtctgatgtcca |
308 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
30162 |
tgtagtaccgacacttctgatcaaaggtgtgtctggtgtcca |
30121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 268 - 308
Target Start/End: Complemental strand, 50762 - 50722
Alignment:
| Q |
268 |
gtagcaccgacacttctgatcaaatgtgtgtctgatgtcca |
308 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| | |||||| |
|
|
| T |
50762 |
gtagcaccgacacttctgatcaaaggtgtgtccggtgtcca |
50722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University