View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9360_low_32 (Length: 275)
Name: NF9360_low_32
Description: NF9360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9360_low_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 8822250 - 8821988
Alignment:
| Q |
1 |
gcagcagttttcgccggaccatgtattgaagatgccgtggtagggttctttgagggatgctttgaaggataagagtgcggttctgtctgaaggagaacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8822250 |
gcagcagttttcgccggaccatgtattgaagatgccgtggtagggttctttgagggatgctttgaaggataagagtgcggttctgtctgacggagaacaa |
8822151 |
T |
|
| Q |
101 |
ccgtgtacggtgagaatgacggtggcgagaaaaacggttacgacggagaacgtgaatgaagaagccattggattgggttaagtgattttgttggggtttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8822150 |
ccgtgtacggtgagaatgacggtggcgagaaaaacggttacgacggagaacgtgaatgaagaagccattggattgggttaagtgattttgttggggtttg |
8822051 |
T |
|
| Q |
201 |
catgggtttatatatatgaggtgagtgacgaaattgccccttgtgtgggtattattgcgctct |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8822050 |
catgggtttatatatatgaggtgagtgacgaaattgccccttgtgtgggtattattgcgctct |
8821988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University