View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9360_low_33 (Length: 260)
Name: NF9360_low_33
Description: NF9360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9360_low_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 14 - 244
Target Start/End: Original strand, 30771857 - 30772087
Alignment:
| Q |
14 |
aaaaatcacatctcacgcttttaaataaaccttaaatgctcattaatattgacacaagaccaatttggcattaacactatatagctcggccataggtttt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30771857 |
aaaaatcacatctcacgcttttaaataaaccttaaatgctcattaatattgacacaagaccaatttggcattaacactatatatgtcggccataggtttt |
30771956 |
T |
|
| Q |
114 |
gactcaaaaaaggtgaaaggtatggtttaatggttacttctagttccacatattgaacaataatctttcacaatctctttacggctaattttctgtttac |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30771957 |
gactcaaaaaaggtgaaaggtatggtttaatggttacttctagttccacatattgaacaataatctttcacaatatctttacggctaattttctgtttac |
30772056 |
T |
|
| Q |
214 |
tcctcttgcattttcggtttgcctgtatgga |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
30772057 |
tcctcttgcattttcggtttgcctgtatgga |
30772087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University