View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9360_low_35 (Length: 258)
Name: NF9360_low_35
Description: NF9360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9360_low_35 |
 | |
|
| [»] scaffold1983 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 12 - 246
Target Start/End: Complemental strand, 28565590 - 28565356
Alignment:
| Q |
12 |
acagactcataaccgcaagtgcttaaggcatctgcctaattgccaatcatagcagaaaagggaaactaataactaccaaaacttaaagaaggatatgctt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28565590 |
acagactcataaccgcaagtgcttaaggcatctgcctaattgccaatcatagcagaaaagggaaactaataactaccaaaacttaaagaaggatatgctt |
28565491 |
T |
|
| Q |
112 |
caaaatggttcagcttgtaatttagacaaaaaataataatttctaggtgggattttctcttatgtgggaacactagagaagagatggaaaataaagagaa |
211 |
Q |
| |
|
||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28565490 |
caatatggttcagctcgtaatttagacaaaaaataataatttctaggtgggattttctcttatgttggaacactagagaagagatggaaaataaagagaa |
28565391 |
T |
|
| Q |
212 |
agagaagaaccagtaatgagagctgatgtttcttc |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
28565390 |
agagaagaaccagtaatgagagctgatgtttcttc |
28565356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1983 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold1983
Description:
Target: scaffold1983; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 200 - 247
Target Start/End: Complemental strand, 829 - 782
Alignment:
| Q |
200 |
aaataaagagaaagagaagaaccagtaatgagagctgatgtttcttct |
247 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
829 |
aaataaagagaaagagaggaaccgataatgagagctgatgtttcttct |
782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University