View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9360_low_42 (Length: 243)
Name: NF9360_low_42
Description: NF9360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9360_low_42 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 7 - 160
Target Start/End: Complemental strand, 27934955 - 27934802
Alignment:
| Q |
7 |
tatggtggtgtgtgggcaataataccgactgcattatgtggtcaaaaattgaaaaacaaaaatgctacccaaaannnnnnnnnnnnatagccccca-ttt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| ||| |||||||||| ||| |
|
|
| T |
27934955 |
tatggtggtgtgtgggcaataataccgagtacattatgtggtcaaaaattgaaaaacaaaaatgctaccc-aaatttattttttttatagcccccatttt |
27934857 |
T |
|
| Q |
106 |
tttgttacttgcaccaaaaaatagcaaagtaagtgtattctcttttttcttatcc |
160 |
Q |
| |
|
||| |||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27934856 |
ttttttacttgcaccaaaaaatagaaaagtaagtgtattctcttttttcttatcc |
27934802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University