View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9360_low_48 (Length: 232)

Name: NF9360_low_48
Description: NF9360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9360_low_48
NF9360_low_48
[»] chr4 (3 HSPs)
chr4 (18-223)||(34944421-34944626)
chr4 (36-147)||(34947771-34947882)
chr4 (142-218)||(34948774-34948850)
[»] chr2 (2 HSPs)
chr2 (24-196)||(4178798-4178970)
chr2 (35-196)||(4167871-4168032)


Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 223
Target Start/End: Original strand, 34944421 - 34944626
Alignment:
18 aataaagggaacatatgttatggatttgccacatttaaaggcttatggatcattgatggatcagctacacttccacatgaacttgatgcaaaatatcaac 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34944421 aataaagggaacatatgttatggatttgccacatttaaaggcttatggatcattgatggatcagctacacttccacatgaacttgatgcaaaatatcaac 34944520  T
118 taaggttcattgatttcatgcatgcaattatgtcaattttggttttttcagctaatgcaatgtttgatcataatgtggttaactgtttctttccatcacc 217  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
34944521 taaggttcattgatttcatgcatgcaattatgtcaattttggttttttcagctattgcaatgtttgatcataatgtggttaactgtttctttccatcacc 34944620  T
218 tccata 223  Q
    | ||||    
34944621 ttcata 34944626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 36 - 147
Target Start/End: Original strand, 34947771 - 34947882
Alignment:
36 tatggatttgccacatttaaaggcttatggatcattgatggatcagctacacttccacatgaacttgatgcaaaatatcaactaaggttcattgatttca 135  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
34947771 tatggatttgccacatttaaaggcttatggatcattgatggatcagctacacttccacatgaacttgatgcaaaatatcaactaaggttgattgatttca 34947870  T
136 tgcatgcaatta 147  Q
    ||||||||||||    
34947871 tgcatgcaatta 34947882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 142 - 218
Target Start/End: Original strand, 34948774 - 34948850
Alignment:
142 caattatgtcaattttggttttttcagctaatgcaatgtttgatcataatgtggttaactgtttctttccatcacct 218  Q
    |||||||| |||| |||||||||||||||| ||||||||||||  |||| ||||||||||||||| ||||| |||||    
34948774 caattatgccaatcttggttttttcagctattgcaatgtttgacgataacgtggttaactgtttccttccaccacct 34948850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 24 - 196
Target Start/End: Complemental strand, 4178970 - 4178798
Alignment:
24 gggaacatatgttatggatttgccacatttaaaggcttatggatcattgatggatcagctacacttccacatgaacttgatgcaaaatatcaactaaggt 123  Q
    ||||| || |||||||| |||||||| || || ||||| ||| | |||||||||||| | | |||||||| | || ||| |||||||||||   ||| ||    
4178970 gggaatatttgttatgggtttgccaccttcaagggcttgtgggttattgatggatcaaccaaacttccacctcaagttgctgcaaaatatcgcataaagt 4178871  T
124 tcattgatttcatgcatgcaattatgtcaattttggttttttcagctaatgcaatgtttgatcataatgtggt 196  Q
    | || |||||||||||||| || ||||||||| |||| ||| |||| | |||| |||||||||| ||||||||    
4178870 ttatagatttcatgcatgcgatgatgtcaattctggtgtttgcagcaattgcattgtttgatcagaatgtggt 4178798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 35 - 196
Target Start/End: Complemental strand, 4168032 - 4167871
Alignment:
35 ttatggatttgccacatttaaaggcttatggatcattgatggatcagctacacttccacatgaacttgatgcaaaatatcaactaaggttcattgatttc 134  Q
    |||||| |||||||| ||||| ||||| ||| | |||||||||||| | | |||||||| | || ||| ||| ||||| |   || |||| || |||||     
4168032 ttatgggtttgccacctttaagggcttgtgggttattgatggatcaaccaaacttccacctcaagttgctgctaaataccgcatacggtttatagatttt 4167933  T
135 atgcatgcaattatgtcaattttggttttttcagctaatgcaatgtttgatcataatgtggt 196  Q
    ||||||||| | ||||||||| |||| ||| |||| | |||| |||||||||  ||||||||    
4167932 atgcatgcagtaatgtcaattctggtgtttgcagcaattgcattgtttgatcggaatgtggt 4167871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University